Skip to main content
A brick plot displays DNA/RNA sequences, tandem repeat structures, or any character-encoded per-row data as colored rectangles. Each character in a sequence is drawn as a brick; the color is determined by a template mapping characters to CSS colors.

​
When to Use

  • DNA/RNA visualization: Display nucleotide sequences with standard colors (A=green, C=blue, G=orange, T/U=red)
  • Tandem repeat analysis: Show BLADERUNNER strigar format repeat motifs
  • Protein secondary structure: Visualize helix/strand/coil patterns
  • Multiple sequence alignment: Compare sequences with positional coloring
  • Any character-encoded data: When each position encodes a discrete state

​
Basic Example

use std::collections::HashMap;
use kuva::plot::BrickPlot;
use kuva::plot::brick::BrickTemplate;
use kuva::backend::svg::SvgBackend;
use kuva::render::render::render_multiple;
use kuva::render::layout::Layout;
use kuva::render::plots::Plot;

let tmpl = BrickTemplate::new().dna();

let plot = BrickPlot::new()
    .with_sequences(vec![
        "CGGCGATCAGGCCGCACTCATCATCATCATCAT",
        "CGGCGATCAGGCCGCACTCATCATCATCATCATCAT",
    ])
    .with_names(vec!["read_1", "read_2"])
    .with_template(tmpl.template)
    .with_x_offset(18.0);

let plots = vec![Plot::Brick(plot)];
let layout = Layout::auto_from_plots(&plots)
    .with_title("DNA Repeat Region");

let svg = SvgBackend.render_scene(&render_multiple(plots, layout));
std::fs::write("brick.svg", svg).unwrap();

​
Input Modes

​
Sequence Mode: with_sequences + with_template

Load raw character strings and color template. 
use kuva::plot::brick::BrickTemplate;

let tmpl = BrickTemplate::new().dna();  // A=green, C=blue, G=orange, T=red

let plot = BrickPlot::new()
    .with_sequences(vec!["ACGTACGT", "ACGTACGT"])
    .with_names(vec!["seq_1", "seq_2"])
    .with_template(tmpl.template);
Each character must have an entry in the template; unknown characters cause a panic.

​
Built-in Templates

BrickTemplate::new().dna() — Standard DNA colors:
  • A → rgb(0,150,0) (green)
  • C → rgb(0,0,255) (blue)
  • G → rgb(209,113,5) (orange)
  • T → rgb(255,0,0) (red)
BrickTemplate::new().rna() — Standard RNA colors:
  • A → green
  • C → blue
  • G → orange
  • U → red

​
Custom Template

use std::collections::HashMap;

let mut tmpl = HashMap::new();
tmpl.insert('H', "steelblue".to_string());   // helix
tmpl.insert('E', "firebrick".to_string());   // strand
tmpl.insert('C', "#aaaaaa".to_string());     // coil

let plot = BrickPlot::new()
    .with_sequences(vec!["HHHCCCEEEE"])
    .with_names(vec!["prot_1"])
    .with_template(tmpl);

​
Strigar Mode: with_strigars

Load structured tandem-repeat motif data in BLADERUNNER format. 
let strigars = vec![
    ("CAT:A,T:B".to_string(), "14A1B1A".to_string()),
    ("CAT:A,C:B".to_string(), "12A1B3A".to_string()),
];
let plot = BrickPlot::new()
    .with_names(vec!["read_1", "read_2"])
    .with_strigars(strigars);
Motif string: comma-separated kmer:letter assignments (e.g. "CAT:A,C:B" binds CAT to local letter A). Strigar string: run-length encoded local letters (e.g. "10A1B4A" = 10 A’s, 1 B, 4 A’s). with_strigars normalizes k-mers across reads by canonical rotation, assigns global letters (A, B, C, …) ordered by frequency, auto-generates colors from a 10-color palette, and computes variable brick widths proportional to motif length.

​
Key Methods

​
Data Loading

​
with_sequences(sequences)

Load sequences — one string per row, ordered top to bottom. 
let plot = BrickPlot::new()
    .with_sequences(vec!["ACGTACGT", "ACGTACGT"]);

​
with_names(names)

Load row labels — one name per sequence, rendered on y-axis. 
let plot = BrickPlot::new()
    .with_sequences(vec!["ACGT"])
    .with_names(vec!["read_1"]);

​
with_template(template: HashMap<char, String>)

Set character-to-color mapping. 
let tmpl = BrickTemplate::new().dna();
let plot = BrickPlot::new()
    .with_template(tmpl.template);

​
with_strigars(strigars)

Load strigar data; switches to strigar mode with auto-generated colors and variable-width bricks. 
let strigars = vec![
    ("CAT:A,T:B".to_string(), "14A1B1A".to_string()),
];
let plot = BrickPlot::new()
    .with_strigars(strigars);

​
Alignment

​
with_x_offset(x_offset: f64)

Apply global x-offset to all rows. Shifts sequences left by x_offset characters. 
let plot = BrickPlot::new()
    .with_x_offset(18.0);  // skip 18-character common prefix
Use to align region of interest at x = 0.

​
with_x_offsets(offsets)

Apply independent per-row offsets. Accepts f64 or Option<f64> values. 
let plot = BrickPlot::new()
    .with_x_offset(12.0)  // global fallback
    .with_x_offsets(vec![Some(18.0), Some(10.0), None]);  // row-specific
Plain f64 treated as Some(v); None falls back to global x_offset.

​
Display

​
with_values()

Overlay character label inside each brick. 
let plot = BrickPlot::new()
    .with_values();
Useful for short sequences or large bricks where text is readable.

​
Examples

​
DNA Repeat Region

let tmpl = BrickTemplate::new().dna();

let plot = BrickPlot::new()
    .with_sequences(vec![
        "CGGCGATCAGGCCGCACTCATCATCATCATCAT",
        "CGGCGATCAGGCCGCACTCATCATCATCATCATCAT",
        "CGGCGATCAGGCCGCACTCATCATCATCAT",
    ])
    .with_names(vec!["read_1", "read_2", "read_3"])
    .with_template(tmpl.template)
    .with_x_offset(18.0);  // skip common prefix

let plots = vec![Plot::Brick(plot)];
let layout = Layout::auto_from_plots(&plots)
    .with_title("CAT Repeat Region");
Three reads with CAT trinucleotide repeats; common prefix skipped.

​
RNA Sequence

let tmpl = BrickTemplate::new().rna();

let plot = BrickPlot::new()
    .with_sequences(vec![
        "AUGCAUGCAUGCAUG",
        "AUGCAUGCAUGC",
    ])
    .with_names(vec!["rna_1", "rna_2"])
    .with_template(tmpl.template);

let plots = vec![Plot::Brick(plot)];
let layout = Layout::auto_from_plots(&plots)
    .with_title("RNA Sequences");
RNA with U instead of T.

​
Protein Secondary Structure

let mut tmpl = HashMap::new();
tmpl.insert('H', "steelblue".to_string());   // helix
tmpl.insert('E', "firebrick".to_string());   // strand
tmpl.insert('C', "#aaaaaa".to_string());     // coil

let plot = BrickPlot::new()
    .with_sequences(vec![
        "HHHHHCCCCEEEECCCHHHHHH",
        "HHHCCCEEEEECCCHHHHH",
    ])
    .with_names(vec!["prot_1", "prot_2"])
    .with_template(tmpl);

let plots = vec![Plot::Brick(plot)];
let layout = Layout::auto_from_plots(&plots)
    .with_title("Protein Secondary Structure");
Custom alphabet: H (helix), E (strand), C (coil).

​
Strigar Tandem Repeats

let strigars = vec![
    ("CAT:A,T:B".to_string(), "14A1B1A".to_string()),
    ("CAT:A,C:B".to_string(), "12A1B3A".to_string()),
    ("CAT:A,CATCAT:B".to_string(), "10A1B2A".to_string()),
];

let plot = BrickPlot::new()
    .with_names(vec!["read_1", "read_2", "read_3"])
    .with_strigars(strigars);

let plots = vec![Plot::Brick(plot)];
let layout = Layout::auto_from_plots(&plots)
    .with_title("Tandem Repeat Strigar");
BLADERUNNER format: motifs normalized, colors auto-generated, widths proportional to motif length.

​
Per-Row Alignment

let tmpl = BrickTemplate::new().dna();

let plot = BrickPlot::new()
    .with_sequences(vec![
        "AAAACGTCGTCGTCGT",
        "AACGTCGTCGTCGT",
        "ACGTCGTCGTCGT",
    ])
    .with_names(vec!["read_1", "read_2", "read_3"])
    .with_template(tmpl.template)
    .with_x_offsets(vec![4.0, 2.0, 1.0]);  // skip different prefix lengths

let plots = vec![Plot::Brick(plot)];
let layout = Layout::auto_from_plots(&plots)
    .with_title("Per-Row Alignment");
Each read has different prefix length; aligned at start of repeat.

​
Character Display

By default, bricks are solid colored rectangles. Call with_values() to overlay the character inside each brick (useful for short sequences or when brick size is large enough for legible text).

​
See Also

  • Heatmap — For numeric grids instead of character sequences
  • [Multiple sequence alignment tools] — For phylogenetic analysis

Build docs developers (and LLMs) love

Get started for freeTalk to us